Microsatellite list for biodiversity studies in chickens

Nr.

Name

Chr.

Map

Primer sequence (5’ -> 3’)

Forward

Reverse

Annealing temperature

Genbank

(Accession Number)

Multiplex

Allele range

Diversity studies

ADL0268

1

M1

CTCCACCCCTCTCAGAACTA

CAACTTCCCATCTACCTACT

60°C

G01688

X1

102-116

R1, R2, R4, R5

MCW0206

2

M2

ACATCTAGAATTGACTGTTCAC

CTTGACAGTGATGCATTAAATG

60°C

AF030579

X7

221-249

R2, R4, R5,

LEI0166

3

M3

CTCCTGCCCTTAGCTACGCA

TATCCCCTGGCTGGGAGTTT

60°C

X85531

X1

354-370

R1, R4

MCW0295

4

M4

ATCACTACAGAACACCCTCTC

TATGTATGCACGCAGATATCC

60°C

G32051

X3

88-106

R1,R2, R4, R5

MCW0081

5

M6

GTTGCTGAGAGCCTGGTGCAG

CCTGTATGTGGAATTACTTCTC

60°C

none

X2

112-135

R1,R2, R4, R5

MCW0014

6

M7

TATTGGCTCTAGGAACTGTC

GAAATGAAGGTAAGACTAGC

58°C

none

X4

164-182

R1,R2, R4, R5

MCW0183

7

M8

ATCCCAGTGTCGAGTATCCGA

TGAGATTTACTGGAGCCTGCC

58°C

G31974

X4

296-326

R1,R2, R4, R5

ADL0278

8

M25

CCAGCAGTCTACCTTCCTAT

TGTCATCCAAGAACAGTGTG

60°C

G01698

X1

114-126

R1,R2, R4, R5

MCW0067

10

M9

GCACTACTGTGTGCTGCAGTTT

GAGATGTAGTTGCCACATTCCGAC

60°C

G31945

X6

176-186

R1,R2, R4, R5

MCW0104

13

M10

TAGCACAACTCAAGCTGTGAG

AGACTTGCACAGCTGTGTACC

60°C

none

X5

190-234

R6

MCW0123

14

M11

CCACTAGAAAAGAACATCCTC

GGCTGATGTAAGAAGGGATGA

60°C

none

X5

76-100

R6

MCW0330

17

M12

TGGACCTCATCAGTCTGACAG

AATGTTCTCATAGAGTTCCTGC

60°C

G32085

X6

256-300

R1, R2, R6

MCW0165

23

M13

CAGACATGCATGCCCAGATGA

GATCCAGTCCTGCAGGCTGC

60°C

none

X5

114-118

R6

MCW0069

E60C04W23

M14

GCACTCGAGAAAACTTCCTGCG

ATTGCTTCAGCAAGCATGGGAGGA

60°C

none

X2

158-176

R2, R4, R5

MCW0248

W29

M15

GTTGTTCAAAAGAAGATGCATG

TTGCATTAACTGGGCACTTTC

60°C

G32016

X1

205-225

R1,R2, R4, R5



MCW0111

1

M16

GCTCCATGTGAAGTGGTTTA

ATGTCCACTTGTCAATGATG

60°C

L48909

X3

96-120

R1,R2, R4, R5

MCW0020

1

M17

TCTTCTTTGACATGAATTGGCA

GCAAGGAAGATTTTGTACAAAATC

60°C

none

X5

179-185

R6

MCW0034

2

M18

TGCACGCACTTACATACTTAGAGA

TGTCCTTCCAATTACATTCATGGG

60°C

none

X2

212-246

R4, R5

LEI0234

2

M27

ATGCATCAGATTGGTATTCAA

CGTGGCTGTGAACAAATATG

60°C

Z94837

X3

216-364

R4

MCW0103

3

M19

AACTGCGTTGAGAGTGAATGC

TTTCCTAACTGGATGCTTCTG

64°C

G31956

X7

266-270

R2, R4, R5

MCW0222

3

M20

GCAGTTACATTGAAATGATTCC

TTCTCAAAACACCTAGAAGAC

60°C

G31997

X2

220-226

R2, R4, R5

MCW0016

3

M28

ATGGCGCAGAAGGCAAAGCGATAT

TGGCTTCTGAAGCAGTTGCTATGG

60°C

none

X3

162-206

R6

MCW0037

3

M24

ACCGGTGCCATCAATTACCTATTA

GAAAGCTCACATGACACTGCGAAA

64°C

none

X3

154-160

R4, R5

MCW0098

4

M21

GGCTGCTTTGTGCTCTTCTCG

CGATGGTCGTAATTCTCACGT

60°C

none

X6

261-265

R2, R4, R5

LEI0094

4

M5

GATCTCACCAGTATGAGCTGC

TCTCACACTGTAACACAGTGC

60°C

X83246

X1

247-287

R4

MCW0284

4

M30

CAGAGCTGGATTGGTGTCAAG

GCCTTAGGAAAAACTCCTAAGG

60°C

G32043

X8

235-243

R4

MCW0078

5

M22

CCACACGGAGAGGAGAAGGTCT

TAGCATATGAGTGTACTGAGCTTC

60°C

none

X6

135-147

R1,R2, R4, R5

LEI0192

6

M29

TGCCAGAGCTTCAGTCTGT

GTCATTACTGTTATGTTTATTGC

60°C

Z83797

X8

244-370

R4

ADL0112

10

M23

GGCTTAAGCTGACCCATTAT

ATCTCAAATGTAATGCGTGC

58°C

G01725

X4

120-134

R1,R2, R4, R5

MCW0216

13

M26

GGGTTTTACAGGATGGGACG

AGTTTCACTCCCAGGGCTCG

60°C

AF030586

X1

139-149

R2, R4, R5

References:

  1. Eding, H. (2002), Conservation of Genetic Diversity, Diss Wageningen University.

  2. Van Marle Koster, E. and Nei, L.H. (2000), Genetic characterisation of native southern African chicken populations: Evaluation and selection of polymorphic microsatellite markers. South African Journal of Animal Science, 30: 1-6.

  3. Wimmers, K., Ponsuksili, S., Hardge, T., Valle-Zerate, A., Marthur, P.K. and Horst, P. (2000) Genetic distinctness of African, Asian and South American local chickens. Animal Genetics. 31: 159-165.

  4. Rosenberg et al. (2001), Empirical Evaluation of Genetic Clustering Methods Using Multilocus Genotypes From 20 Chicken Breeds, Genetics 159, 699-713. AVIANDIV project (http://aviandiv.tzv.fal.de>)

  5. Hillel et al., (2003), Biodiversity of 52 chicken populations assessed by microsatellite typing of DNA pools, Genet. Sel. Evol. 35 533-557. AVIANDIV project

  6. Weigend et al., unpubl. AVIANDIV project


Multiplexes:

  1. Multiplex Master Mix Qiagen: ADL0278, ADL0268, LEI0094, MCW0248, MCW0216

  2. Multiplex Master Mix Qiagen: MCW0081+MCW0034+MCW0069+MCW0222+MCW0295

  3. Multiplex Master Mix Qiagen: MCW0111, MCW0037, MCW0016, LEI0166, LEI0234

  4. Multiplex Master Mix Qiagen: MCW0183, ADL0112, MCW0014

  5. Multiplex Master Mix Qiagen: MCW0165, MCW0020, MCW0123, MCW0104

  6. Multiplex Master Mix Qiagen: MCW0078+MCW0067+MCW0330+ MCW0098

  7. Hot Star Taq Master Mix Qiagen : MCW0206, MCW0103

  8. no information